genetics extra credit genetics extra credit genetics extra credit GENETICS EXTRA
ID: 253866 • Letter: G
Question
genetics extra credit genetics extra credit genetics extra credit GENETICS EXTRA CREDIT-5 PTS, ON LECTURE EXAM 111 3'TACAATGCCAGTGGTTCGCACATT5 1. Give the base sequence of the complementary DNA strand (the other side) for the above molecule. 2. Give the base sequence of the strand of mRNA which would be constructed from the original DNA strand 3. What amino acid sequence would this mRNA code for? 4. If the seventh nucleotide of the original strand of DNA were changed from G to C, what would the resulting mRNA read? Include the entire strand 5. What would the resulting amino acid sequence be? Include the entire sequence. What type of mutation is this? Ifa G were added to the original DNA strand after the 6h nucleotide, what would the resulting mRNA read? Include the entire strand. 6. 7. What would the resulting amino acid sequence be? Include the entire sequence. What type of mutation is this? ucleotide on the original DNA strand were changed from G to C, what would the resuitin mRNA strand read? Include the entire strand 9. What would be the resulting amino acid sequence? Include the entire sequence, What type of mutation is this? 3'TACCACGTGGACTGAGGACTCCTCACT5 What is the mRNA sequence that would result from this DNA sequence above? What is the amino acid sequence that result from this mRNA sequence? If the 20h nucleotide in the original DNA molecule were changed from T to A, what mRNA would the new DNA 10. 11. 12. code for? Include the entire strand. what is the amino acid sequence that would result from this mRNA sequence? ynattpeotmutationi this? 13. This is the change that results in sickle cell anemia. On the back of this page, describe the occurrence of sickle cell anemia, the phenotype and genotype of the disease, and the relationship of sickle cell anemia and malaria.Explanation / Answer
1) 5' A T G T T A C G G T C A C C A A G C G T G T A A 3'
2) 5' A U G U U A C G G U C A C C A A G C G U G U A A 3'
3) Met Stop
4) If G is changed to C in the original DNA strand
3' T A C A A T C C C A C T C C T T C C C A C A T T 5' - original DNA strand
5' A U G U U A G G G U G A C C A A G G G U G U A A 3' - mRNA strand
Met stop Gly Stop Pro Arg Val Stop
the amino acid read will remains same.
5) The resulting mRNA strand codes for only Methionine because after that stop codon will appeared.
this is a point mutation ( transition G-C) .
6) If G is added at the 6 nucleotide
3' T A C A A T G G C C A G T G G T T C G C A C A T T 5' - original DNA strand
5' A U G U U A C C G G U C A C C A A G C G U G U U U 3' - mRNA strand
7) The resulting mRNA strand codes for only Methionine because after that stop codon will appeared.
this is a point mutation ( taddition ) .
8) If G is changed to C at 11 nucleotide position in the original DNA strand
3' T A C A A T G C C A C T G G T T C G C A C A T T 5' - original DNA strand
5' A U G U U A C G G U G A C C A A G C G U G U U U 3' - mRNA strand
9) The resulting mRNA strand codes for only Methionine because after that stop codon will appeared.
this is a point mutation ( transition G-C) .
10) 5' A U G G U G C A C C U G A C U C C U G A G G A G U G A 3'
11) Met Val His Leu Thr Pro Glu Glu Stop
12) If T is changed to A at 20 nucleotide position in the original DNA strand
3' T A C C A C G T G G A C T G A G G A C A C C T C A C T 5 ' - original DNA strand
5' A U G G U G C A C C U G A C U C C U G U G G A G U G A 3' - mRNA strand
13) Met Val His Leu Thr Pro Val Glu Stop ( by this mutation glu is changed to Val )
this is a point mutation ( transition T- A) .
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.