HELP WITH C PLEASE We performed a final experiment where we determined the tight
ID: 253471 • Letter: H
Question
HELP WITH C PLEASE
We performed a final experiment where we determined the tightness of DNA packaging for this gene in wild-type toe cells, and in toe cells in which the Talon enhancer had been mutated as described for constructs g-k. In this experiment we isolated chromatin and determined if an enzyme cuts in the gene very well or very poorly, depending on how tightly packed the DNA is at the site of cutting.
c. Suggest why the ability of an enzyme to cut chromatin at a specific location might tell us about chromatin structure; specifically packing of DNA.
The Talon gene also is regulated by two Transcription factors named Hippogenin and Griffogenin. These factors bind to the DNA sequences 5'AATT3' (for Hippogenin) and 5'CCCGGG3' (for Griffogenin). Underneath the sequence is shown the structures of five enhancer variants: the wild-type enhancer (g plus four deletion mutants (h through k). Each variant was tested for its ability to help the promoter to increase the transcription of the Talon gene. Relative levels of expression are shown to the right. TGATGCT.activity Relative gene 5-AGCTGAGAATTCGCGATGCATGGAATTCGAGAGGAGCTTGCATCCCGGGAGCT 1000 Units 500 Units 500 Units 10 Units 10 Units 9Explanation / Answer
It is given that the Talon gene is regulated by two transcription factors namely Hippogenin and Griffogenin.
Hippogenin binds to 5’-AATT-3’ while Griffogenin binds to 5’-CCCGGG-3’.
In the variant ‘h’, 5’-AATT-3’ is missing. So, hippogenin has no place to bind. So, gene expression will be lowered/ halved.
In the variant ‘i’, TATA box seems to be missing. So, RNA polymerase has no place to bind. So, gene expression will be lowered/ halved.
In the variant ‘j’, both 5’-AATT-3’ and 5’-CCCGGG-3’ are missing. Transcription factors will be unable to bind. Only minute gene expression will occur due to binding of RNA polymerase to the TATA box (10 units).
In the variant ‘k’, 5’-CCCGGG-3’ is missing. So, griffogenin has no place to bind. So, gene expression will be lowered. This further implies that 5’-CCCGGG-3’ is the enhancer site. Without this, gene expression is not expected in this gene.
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.