Forward primer: Reverse primer: Please explain how to figure this out. 20. The f

Question

Forward primer:

Reverse primer:

Please explain how to figure this out.

20. The figure below shows a region of genomic DNA that you need to amplify by PCR. The target site has been chosen for you All you need to do is write down the sequence of the primers you will use in your PCR experiment. Be sure your primers are each 200 nucleotides long and that they will produce the 140 bp product indicated by the figure. (Note that as is common, you have the sequence of one strand of the DNA.) 5' -AACCGCGAATGCATGATGCT GGATCGAGAGCACCAT CGCC-3 exactly 100. bp between the arrowheads

Explanation / Answer

Forward primer: AACCGCGAATGCATGATGCT

Reverse primer: GGCGATGGTGCTCTCGATCC

Explanation: The above mentioned each primer is about 20 nucleotides. These are the correct primers to amplify the 140 bp DNA sequence mentioned above.

When you are designing primers, take the single strand and consider the first 20 bases as a Forward primer and take the last 20 bases and reverse complement it, this acts as a Reverse primer. It means the primer should be complementary to the last 20 bases and run toward opposite direction, toward the farward primer.

Related Questions

Navigate

• Browse (All)
• Browse F
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.