Refer to the picture of the pGEX-6P-2 MCS sequence diagram while you answer this

Question

Refer to the picture of the pGEX-6P-2 MCS sequence diagram while you answer this question:

1) Design and write out the sequence of a pair of primers that could be used to amplify all of the DNA between the lysine codon and the stop codon (Show where these are). Amplification of some DNA outside these regions is acceptable. Annotate the 5’ and 3’ ends of the primers. Please explain your design process as part of your answer. Include a calculation of Tm for each primer and the complentary strands as necessary.

2) Annotate clearly it to show exactly (to the base) where each of your primers lie. Indicate whether your primers are the SAME sequence as shown on the diagram or the COMPLEMENTARY sequence to the one shown in the diagram. Put an arrow on the end of each annotated region to show the direction the primer points (the end where the polymerase will bind and begin extension). Label this end 5’ or 3’, depending on how you have designed your primer.

BamHI ggt ggc gac cat cct cca aaa tcg gat ctg gaa gtt ctg ttc cag ggg ccc ctg gga tcc 60 10 20 30 40 50 Smal HincII Sall EcoRI Xmal Xhol cca gga att ccc ggg tcg act cga gcg gcc gca tcg tga ctg act gac gat ctg cct cgc 120 110 70 80 90 100 geg ttt cgg tga tga cgg tga aaa cct ctg aca cat gca g 160 150 130 140

Explanation / Answer

1)

GGTGGCGACCATCCTCCAAAATCGGATctggaagttctgttccaggggcccctgggatccccaggaattcccgggtcgactcgagcggccgcatcgTGACTGACTGACGATCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAG

The region from Lysine till stop codon is Bold

Leucine is showed in Bold italicised lower alphabets

Stop codon TGA is Bold italicised capitals.

Primers are underlined. These are primer binding sites.

The primers with the details are-

This will amplify the regions with some regions outside the DNA regions. This will help in sequencing using one primer during sequencing first 20bp after the primer are not readable.. This will help in reading the complete region.

2)

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity Forward primer CGACCATCCTCCAAAATCGG Plus 20 6 25 58.70 55.00 3.00 2.00 Reverse primer TGTGTCAGAGGTTTTCACCGT Minus 21 155 135 59.79 47.62 3.00 3.00

Related Questions

Navigate

• Browse (All)
• Browse R
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.