I have no idea how to asnwer these questions; I\'ve searched on chegg to try and
ID: 221434 • Letter: I
Question
I have no idea how to asnwer these questions; I've searched on chegg to try and figure it out but I'm still not sure. I have the answers to 1-5 so please just help with 6-10 and please show how you got the answers!
My Query Sequence: TTGGCATTCCCCACTTGAGAATTACCCTTT
1. Identify the gene from which the query sequence originates (Name of gene)
2. Provide the full protein sequence encoded by the gene.
3. Are different splice variants known for this gene?
4. What human disease has been connected to this gene?
5. Calculate molecular weight (kiloDalton kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.
6. Provide the reference (in proper reference form: Author; Year; Title; Journal Name; Volume; Page Numbers) for a recent publication involving the identified gene. This reference should NOT be a web page reference.
7. Are there homologues for the identified gene in other systems? Identify one homologue in a invertebrate system (if there is none, provide a vertebrate homologue).
8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease etc.) of the protein(s) encoded by the gene.
9. Generate a protein sequence alignment for one of the identified putative protein products with at least one similar invertebrate protein (if there is none, use a vertebrate homologue).
10. Generate a secondary structure prediction for one identified protein.
Explanation / Answer
1. Query Sequence: TTGGCATTCCCCACTTGAGAATTACCCTTT when used to do the BLAST at the NCBI gave the following result: Papio anubis interleukin 2 receptor subunit gamma (IL2RG), transcript variant X2, mRNA. Hence it is interleukin 2 receptor subunit gamma gene.
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.