The DNA sequences of a gene from three independently isolated mutants are shown

Question

The DNA sequences of a gene from three independently isolated mutants are shown below Using this information, 1) what is the sequence of the wild-type gene in this region? Mutant ATGAATCGACTGGTAAACTTTGCTGAGTGA Mutant 2 ATGAGTCGACCGGTAAACTTTGCTGAGTGA Mutant 3 ATGAGTCGACTGGTTAACTTTGCTGAGTGA Mutant 4: ATGAGTCGACTGGTTAACTTTGCTTGAGTGA Wild-type 2 translate all three mutants' DNA sequence into amino acid sequence. 3) find out what kinds of consequences of each mutation has in terms of protein sequence.

Explanation / Answer

wild type = ATGAGTCGACTGGT(A/T)AACTTTGCTGAGTGA

1. met asn Arg leu val asn phe ala glu stop

2. met ser arg leu val asn phe ala glu stop

3. met ser arg leu val asn phe ala glu stop

4, met ser arg leu val asn phe ala stop val

1. G to A occurs ( purine to purine ) transition occurs

2. T to C occurs (pyrimidime to pyrimidine) transition occurs

3. A to T or T to A ( pyrimidine to purine) transversion occurs

4. G to T ( purine to pyrimidine) transversion occurs and further G added in the sequence which terminates the sequence

Related Questions

Navigate

• Browse (All)
• Browse T
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.