You are sequencing the genome of an organism brought back by Elon Musk\'s missio

Question

You are sequencing the genome of an organism brought back by Elon Musk's mission to Mars. Below is part of the sequence that you think is important and you want to amplify it using PCR. List the forward and reverse primers (9 nucleotides for both) that you make to amplify this region. Be sure to label the 5' and 3' ends of both primers and note which is the forward and which is the reverse primer. GTACTAGCCCAATAAAATATTTCAGCACTTTCTGGAGTACCGACTAAAGAACTAGCCGTT GTGTAACCTGCCCAACCGCCTAATGTAATTTTTGGTGTAGGTTGCAAACTAACTTGTACA CCGTAGTTGTTAGATTCAGTTCTATCGGCAGCAACAGTCCCCAGATTATTCGCCAAGGCA CTTCCTGTCGTTCCGAATAAATTGGCAACACCTCTTTGATAACTATGGGCGTAGGTTAGA CCAACGTTGATTGCTTTGTTAGGCTTGAAAGCCAACTGACCAAAGATAGTGTTGCTACCA

Explanation / Answer

1- forward primer and reverse primer

5’ cAUGAUCGG 3’ And 3’ GAUCGGCAA

2- 5’ CACAUUGGA 3’ and 3’ UGAACAUGU 5’

3- 5’ ggcaucaac 3’ and 3’ cgguuccga 5’

4- 5’ gaaggacac 3’ and 3’ auccaaucu 5’

5 - 5’gguugcaac 3’ and 3’ aacgauggu 5’

Note - the primers are written as forward and reverse primer as 5’ to 3’ and 3’ to 5’ respectively .

Related Questions

Navigate

• Browse (All)
• Browse Y
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.