Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Below you can see the cDNA sequence derived from the mRNA of an unknown protein

ID: 217481 • Letter: B

Question

Below you can see the cDNA sequence derived from the mRNA of an unknown protein (the cDNA contains the 5' and the 3' untranslated regions). What are the first 6 and the last 5 amino acids in the sequence of this protein?

agtgttcagagagcttgttcatgagagctggttatcatagacaatttgaaagaaacccaaaaaacagcttccctgacagaagatggcatcgaccgagagagaagacctgacagaaaaggacaagttgaagatggagg tagaccagcttaagaaggaagtgacactggagagaatgatggtttccaaatgttgtgaagaagtgagagattatattgaagaaaggtctggagaagaccctctagtgaaggggattccagaagacaaaaaccccttcaa ggaactcaaaggatgcttagcgagttcataggcgggaaggcattttcttagaatatttagaattttaatgataatgcaaactgttctcctatataattaaactgtgtatgttgtttaaattattaaattttaataaaaataaagatgtaa taatatgtaaactcattttttcatgaagtatttcacataaggtttaacaaggaattaggtgtaatatcgatgaaccctgctttagaagcagtgtattctaaactgcctttgcagttttatattccttcatttttctttcaatattaatgatac ttttctagaacttttttttgtttatctgttttttttgttttttgtttgtttgtttttcaagacaggatttctctgtgcagtcctagctgtcctggaaatcactctgtagaccaggctggcctcgaactcagaaatccacctgcctctgcctccca agtgctggtattaaaggcgtgcgccacaaccgctcggcctcttctagaatttttatagttaaacatattttattctcaattttctcacaggcctacaaagattattgtttcaatacgcggataatttattttagcaaaaaactatgtata tatatactttatatgtactgtatattgtagtatattgtatactacatattgcctattatatataatatacattaattat

Explanation / Answer

First sequence

Stating six amino acid: serine, valine, glutamine, arginine, Alaine , cysteine

Last five amino acid: gkutamine, valine, glutamic acid, aspartic acid, glycine

Second sequence

First six amino acid: threonine, serine, leucine, argnine, arginine,lysine

Last 5 amino acid: threonine, lysine, threonine, proline,serine

Third sequence:

First 6 amino acid: glycine, threonine, glutamine, arginie, methionine

Last 5 amino acid: leucine, isoleucine, lysine, isoleucine, lysine

Fourth sequence

First 5 amino acid: tyrosine, valine , argine, serine, phenylalanine, phenylalaine

Last 5 amino acid : phenylalanine, phenyalanine, phenylalaine, glutamine, tyrosine

Fifth sequence :

First 6 amino acid: phenylalanine, iso leucine, leucine, tyrosine, methionine, tyrosine

Last 5 amino acid: isoleucine, phenylalanine, methionine, iso leucine histidine

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote