9. Explain why spontaneous mutations would or would not have a large effect on t

Question

9. Explain why spontaneous mutations would or would not have a large effect on the allele frequencies in a large population? 10.Why does a small population lead to genetic drift? Does this lead to increased or decreased allelic diversity, why? 11.Assemble a 24 base DNA sequence from these sequence fragments, produced by shotgun sequencing? GATGAC CGATGCG GGCGTCAG GACATGGC TCAGTCGA 12.A polymorphism or polymorphic marker in a genetic sense usually represents a site along a chromosome where a specific nucleotide sequence exists. Name 3 different types of polymorphic markers?

Explanation / Answer

9. The frequency of spontaneous mutations is a very rare phenomenon. Errors during DNA replication or exposure to mutagens would result in mutagenesis. If the population is very large and randomly mating, such low-frequency mutations would not affect the allelic frequencies until and unless they provide a selective advantage to the prevailing environmental conditions.

10. Genetic drift is the change in the allele frequencies of a population due to an accidental event. Smaller populations are highly sensitive changes in allelic frequencies by genetic drift. genetic drift leads to increased genetic diversity.

11. Given DNA sequence: GATGACATGGCGTCAGTCGATGCG

12. Polymorphic markers:

i. SSLP

ii. RFLP

iii. RAPD

Related Questions

Navigate

• Browse (All)
• Browse 9
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.