Question 9 6 pts Below is a DNA fragment comprising the sequence of a gene codin

Question

Question 9 6 pts Below is a DNA fragment comprising the sequence of a gene coding for the human protein CV H ATGAATTCGTAGGTAGGGGATCCGTACTGCAGTTGAAGCTTAAGTCCACCAAAGCTTGAATGGTCTGCAGCTGTTCCTAATG TGGAATTCTTGCGTAACGGATCCCCGT Write in the case the corresponding amino acid sequence of the protein (write in this manner Leu-Gly Leu) You would like to clone this gene in a plasmid next to a constitutive promoter (A constitutive promoter results in the constant transcription of a gene) and then insert this plasmid into bacteria in order to produce a high level of protein CVH. You have the choice between 3 plasmids: pA, pB and pC Multiple Cloning Sites Sites are listed in order Hindl BamH .EcoRI Pstl pA Multiple Cloning Sites Sites are listed in order Pstl BamH Hindlll EcoRI Promoter Multiple Cloning Sites Sites are listed in order Pst Hindll . BamH You also have the following enzymes: EcOR GIAATTC BamHl GIGATCC . Hindlll AAGCTT CTGCAIG Pstl Which plasmid would you use to clone your gene? Which enzyme(s) would you use to cut the plasmid and the DNA fragment to facilitate the insertion of the fragment into the plasmid? You will be asked to explain your answer in the next question.

Explanation / Answer

The first assignment can be answered using the genetic code. Every three RNA bases (codons) you look up which aminoacid is coding for. They give you the coding DNA sequence, so you already have the codons, only you need to change T for U.

For example it starts with ATG. We change it for AUG. Look up for it and it is: Methionine (Met). The second one is AAT, we look in the genetic code with AAU: Asparagine (Asn). And so it continues...

Answer: Met-Asn-Ser- STOP- Val-Gly-Asp-Pro-Tyr-Cys-Ser-STOP-Ser-Leu-Ser-Pro-Pro-Lys-Leu-Glu-Trp-Ser-Ala-Ala-Val-Pro-Asn-Gly-Gln-Ala-Cys-Gly-IIe-Leu-Ala-STOP-Arg-Ile-Pro-Val.

For the second part, the most important thing is to make sure that the enzyme we use does not cut in the middle of our insert. Then, we need to check where these restriction sites are located. We find in our sequence first the EcoRI, then BamHI and Pstl. All of them are BEFORE the second STOP in our protein. That means they are OK if they are cut away, since the large polypeptide we want to encode is between the second and third stop. HindIII cuts immediately after the STOP, hence, we cannot use it. No other site is found until AFTER the third STOP, and that is GGATCC, which works for BamHI.

We are going to use BamHI enzyme only, we can choose either plasmid (since we are only using one enzyme) and the order does not affect in this case.

Good luck!

Related Questions

Navigate

• Browse (All)
• Browse Q
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.