Answer the following questions: Note: Met (the first amino acid) should always b

Question

Answer the following questions:

Note: Met (the first amino acid) should always be included in the total number of the amino acids of every polypeptie.

1- How many amino acids do exist in the product of the expression of the normal gene? Just type the number.

2- How many amino acids do exist in the longest polypeptide? Just type the number.

3- Which allele(s) produce(s) the shortest polypeptide? Just type the allele’s name(s).

4- How many amino acids do exist in the shortest polypeptide? Just type the number.

5- Which mutant allele(s) produce(s) an identical polypeptide as the normal one? Just type the name(s).

6- Which allele(s) produce(s) the longest polypeptide? Just type the name(s).

7- Which polypeptide(s) have (has) a “Ala” in position 11? Just type the name(s).

8- Which polypeptide(s) have (has) a “Glu” in position 9? Just type the name(s).

9- Which polypeptides have the same number of amino acids with partially different primary structures? Just type the name(s).

ASSIGNMENT GUIDE:

1- Express the wild allele (M1, typed below, go through all of the steps of gene expression), and write down the normal product (P1).
2- Note that the promoter of the gene is on the right side of the gene!
3- Apply all of the changes (from # II to # VI, one at a time) on the original wild allele. Each change (mutation) results in generation of a new mutant allele (M2 to M6).

4- Express all of the new alleles (M2 to M6, one by one) to come up with a product for each one (P2 to P6 for the mutant products).

1

3’GCTATATAGGAAGATTAAATAATACAGTAAACGGGCGAGTCTACAAACCGTACTAAATAATGTTACAAAGTATATTTGGCCGATATATCC 5’ 5’CGATATATCCT TCTAATTTATTATGTCAT TTGCCC GCTCAGATGTTTGGCATGATTTATTACAATGTTTCATATAAACCGGCTATATAGG 3’

Note: The promoter is at the right side, and the terminator is at the left side of the gene.

I- Assume that the sequence above is the normal (wild) allele for gene M (let’s call it allele M1). The normal allele M1 encodes polypeptide P1.

II- If base pair G/C is added between positions 35 and 36 of gene M (to allele M1), allele M2 is produced, which encodes polypeptide P2. G is added to the top strand.

III- If base pair C/G is inserted between positions 60 and 61 of gene M (into allele M1), allele M3 is produced, which encodes polypeptide P3. C is added to the top strand.

IV- If base pair number 53 (in allele M1) is changed from C/G to A/T, allele M4 is produced, which encodes polypeptide P4.

V- If base pair A/T is inserted between nucleotides 40 and 41 (into allele M1), allele M5 is produced, which encodes polypeptide P5. A is added to the top strand.

VI- If base pair number 64 (in allele M1) is changed from T/A to C/G, allele M6 is produced, which encodes polypeptide P6.

Explanation / Answer

1. In the expression of the normal gene we need 20 aminoacids ( 2 are recently identified with that 22) are required for the encoding of the gene, if 3 as nucleotide set in a codon 4 x 4 x 4 = 64 aminoacids produced by different nucleotide combinations are possible, but these are only 20 repeatedly involved in expression.

2.For the synthesis of longest peptide till date is 33000 amino acids - Titin. produced by solid phase, hybrid technology synthetically.

3, 4. Shortest polypeptide is dipeptide, which consists of 2 aminoacids linked up by the peptide bond. Example for the dipeptide is carnosine alanine - histidine.

5. homozygous mutant produce same polypeptide as normal one. Example : SIlent mutation There is no change in the sequence as normal and mutant look same

6. Longest polypeptide is TITIN - 33000 aminoacids with 363 exons involved in the producing single gene - protein

Related Questions

Navigate

• Browse (All)
• Browse A
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.