5. Nirenberg and Matthaej as well as Khorana were able to synthesize RNA molecul

Question

5. Nirenberg and Matthaej as well as Khorana were able to synthesize RNA molecules with repeating sets of nucleotides of various lengths and then analyze the amino acid sequence of the proteins that were encoded by these molecules. So for instance, RNA molecules of repeating single nucleotides such as U to give UUww... or A to give AAAAA.... These give rise to single repeating amino acids. Repeating dinucleotides such as UC to give UCUCUCUC...These give rise to repeating units of 2 amino acids (Ser, Leu). Imagine that you carried out this experiment and made 9 RNA types composed of the following repeated sequences: G… GU GUA.. GUAC... GUACC... GUACCG. GUACCG... GUACCGAG... GUACCGAGU... How many amino acids do you expect to make up a repeating unit in tbe polypeptides produced from these RNAs? Name Recitation Section How could this experiment be used to support the hypothesis that the genetic code uses a triplet code? English (US) PROOFREADER

Explanation / Answer

In the process of translation the nucleotide sequence in mRNAis read by the tRNA and translation into protein. The tRNA bring corresponding amino acid as they read through the mRNA. Each three nucleotide corresponds to one amino acid in protein.

1)

In GGGGGGGGG repeats GGG-GGG-GGG will be the codon and coresponding aminoacid sequence is Gly-Gly-Gly-Gly {Gly=glycine}

2)

In GUGUGUGUGUGUGUGUGU : GUG and UGU are the cododn which repeats and the aminoacid sequence will be Val-Cys-Val-Cys-Val-Cys {Val= valine; Cys=cysteine}

3)

In GUAGUAGUAGUAGUAGUAGUA : GUA will be the repeating codon and the aminoacid sequence will be Val-Val-Val-Val{val= valine}

4)

In GUACGUACGUACGUACGUACGUAC : GUA,CGU,ACG,UAC are the codons which repeats the same way, and amino acis sequence will be : Val-Arg-Thr-Tyr-Val-Arg-Thr-Tyr-Val{ Val=valine ;Arg= arginine;thr;threonine;tyr=tyrosine}

5)

GUACCGUACCGUACCGUACCGUACC :GUA,CCG,UAC,CGU,ACC are the codons which repeats the same way, and amino acis sequence will be : Valine-proline-tyrosine-arginine-threonine-Valine-proline-tyrosine-arginine-threonine.

6)

GUACCGGUACCGGUACCG : GUA and CCG are the 2 types of codons and amino acids are Valine-proline-valine-proline-valine-proline

7)

GUACCGAGUACCGAGUACCGAGUACCGA the codons are GUA ,CCG, AGU,ACC,GAG,UAC,CGA, and corresponding aminoacid sequence are Valine-proline-serine-threonine-Glutamine-tyrosine-arginine-valine-proline-serine-threonine-glutamine-tyrosinne-arginine

8)

GUACCGAGGUACCGAGGUACCGAGGUACCGAGG the codons are GUA,CCG,AGG,UAC,CGA,GGU,ACC,GAG, valine-proline-Arginine-tyrosine-Arginine-Glycine-threonine-glutamine-valine-proline-Arginine-tyrosine-arginine -glycien-threonine-glutamine.

9)

GUACCGAGUGUACCGAGUGUACCGAGU : the codons are GUA, CCG,AGU it repeats so on

the amino acids are Valine-proline-serine-valine-proline-serine-valine-proline-serine

Related Questions

Navigate

• Browse (All)
• Browse 5
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.