24.) Find the sequence for the DNA strand below. mRNA never have T\'s in the seq

Question

24.) Find the sequence for the DNA strand below. mRNA never have T's in the sequence! Always use the U in the mRNA DNA code mRNA code Identify each codon (triplet) from the mRNA 25.)If the following were pårt of a DNA chain, what mRNA bases would pair with it to transcribe the DNA code onto mRNA? G-G-A-T-C-G-C-C-T-T-A-G-A-A-T-C TACTTG CATGGAATGGTAACGGTAACTG as translation is Transcription is DNA to 26) How many bases are needed to specify an mRNA co 27.)What is the difference between an amino acid and a protei Multiple choice questions don n?

Explanation / Answer

24. sequence for mRNA

                UACUUGCAUGGAAUGGUAACGGUAACUG

25. Complementary mRNA Sequence (codons)

                CCU-AGC-GGA-AUG-UUAC

                Pro-Ser-Gly-Start-Leu

26. transcription is DNA to mRNA as translation is RNA to proteins

27. 3 bases are required to specify mRNA codons.

28. an amino acid is small subunit and building block of large proteins these are 20 in numbers and have amine and carboxylic group at either end of chain, whereas proteins are the various connected amino acids in specific or random sequence that may be much larger has indefinite numbers of possibilities.

Related Questions

Navigate

• Browse (All)
• Browse 2
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.