7. Primer Design. You need to amplify the entire sequence shown below by PCR. Fu

Question

7. Primer Design. You need to amplify the entire sequence shown below by PCR. Furthermore sequence below must have an EcoRl site (GAATTC) at the 5' terminus, and a BamHI site 3' terminus, when it becomes part of the amplicon. Design 6 bp primers (not coun (GGATCC) at the ting the restriction enzyme sites) that will cloning. (4 points) amplify the sequence and include EcoRI and BamHl sites to facilitate directional GATCGAACAAGAAAATGGTTAAATCGCGGATCATATCAGTACTTGCAACT TGTTTTAACTTGGCCAGCATCCTTTTGCTTCCGGCCAAAAAATATTTGCA AAAGACCAGCTAAGAACTTTACTATTCACGGGCTTTGGCCCGAAATAACG GGGTTCCGTCTAGAGTTCTGCACTGGCAGTCCCAAGTATGAGACTTTCAA a. Write the sequence of your forward primer, with any RE sitels) underlined: B. Write the sequence of your reverse primer, with any RE sitels) underlined

Explanation / Answer

A-

For forward primer, we need to take first six nucleotides of the given sequence and add the restriction site of EcoRI in that.

Fw primer

5'GAATTCGACTGA 3'

B- For a reverse primer, we need to take reverse complement of last six nucleotides and add the restriction site of BamHI in that.

Reverse primer

5' GGATCCTTGAAA 3'

-

Related Questions

Navigate

• Browse (All)
• Browse 7
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.