Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Below are the DNA sequences that encode the first eight amino acids for four all

ID: 188261 • Letter: B

Question

Below are the DNA sequences that encode the first eight amino acids for four alleles of the Adh protein in Drosophila melanogaster. Nucleotides that differ from the first sequence are shown by a lowercase letter.

ATGTCTCTCACCAACAAGAACGTC

ATGgCTCTCACCAACAAGAACGTC

ATGTCgCTCACCAACAAGAACGTC

ATGTCTtTgACCAACAAGAACGTC

a. What are the first eight amino acids for each of these four DNA sequences?

b. For each of the four polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism.

c. Synonymous polymorphisms tend to be more common than nonsynonymous ones. Why might that be?

Explanation / Answer

The 4 sequences are:
ATGTCTCTCACCAACAAGAACGTC
ATGgCTCTCACCAACAAGAACGTC
ATGTCgCTCACCAACAAGAACGTC
ATGTCTtTgACCAACAAGAACGTC

Answer a. The first 8 amino acids given by each of them are:
Using the codon table for conversion of 3-letter genetic codon into amino acid, we get
MetSerLeuThrAsnLysAsnVal
MetAlaLeuThrAsnLysAsnVal
MetSerLeuThrAsnLysAsnVal
MetSerLeuThrAsnLysAsnVal

Answer b.
Polymorphism is an altered nucleotide. Synonymous is when the same amino acid is produced irrespective of the alteration. Non-synonymous is when the amino acid produced is different.

MetSerLeuThrAsnLysAsnVal
MetAlaLeuThrAsnLysAsnVal - Non-synonymous polymorphism
MetSerLeuThrAsnLysAsnVal - Synonymous polymorphism
MetSerLeuThrAsnLysAsnVal - Synonymous polymorphism

Answer c.
Most of the 3-letter codes across the codon table are pretty repetitive for the amino acid that they encode. These polymorphisms generally occur in the third element in the codon, and it happens to be that most amino acids are formed with major emphasis on the first 2 elements of the codon as the third and last element can be any nucleotide but the same amino acid will be formed any way.

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote