5) You wish to amplify the DNA below, by PCR. You want your PCR product to match

Question

5) You wish to amplify the DNA below, by PCR. You want your PCR product to match the shaded region match. Which of the following primer sets should you use? Explain your answer. catcgatgaattcgagctccaccgcggtggcggccgccagatgcgattacagctccaatcacaaa tgagtcagtcaatcaagtggattcaaagtatagacgacgagttctgcactggcttgctgccaatg tcagaggaaaaccggaagatgtcattacaacaatgtgaatgcaagagattgtgatgagaatactg tctgatgctagctgttcgtgcacaccgtgtcagactttccgtagtgcttcttcgtgaaggagct aatccaacaatattcaataattcggagcgaagtgcccttcat a) Forward primer: 5-gccgccagatgcgattac-3 Reverse primer: 5'-ccgtagtgcttcttegtgaa-3' b) Forward primer: 5'-gccgccagatgcgattac-3 Reverse primer: 5' -ttcacgaagaagcactacgg-3' c) Forward primer: 5'-gccgccagatgcgattac-3 Reverse primer: 5'-ggcatcacgaagaagcactt-3

Explanation / Answer

Answer:

5. (b) Forward primer: 5' gccgccagatgcgattac 3'

Reverse primer: 5' ttcacgaagaagcactacgg 3'

The reverse primer in this case is the appropriate reverse complementary of the given DNA strand to be amplified.

Related Questions

Navigate

• Browse (All)
• Browse 5
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.