You are studying the regulatory DNA of a mouse gene expressed in developing hear
ID: 177507 • Letter: Y
Question
You are studying the regulatory DNA of a mouse gene expressed in developing heart liver, and lung tissue. Your preliminary work has shown that heart and lung expression of this gene is controlled by a short fragment of DNA just upstream of the promoter. Based on this result, you decide to investigate this region further to understand its function.You dec de to compare this sequence to the regulatory DNA of the same gene found in rats and humans. Using genome databases, you identify and align the three sequences, shown here. You observe three regions that are conserved between the mouse, rat, and human orthologs of this gene. (Ortholog is the term for a gene that is structurally and functionally conserved between related organisms). From this observation, you hypothesize that this region of regulatory DNA binds three regulatory proteins one at each conserved region. Region 3 Region 1 Region 2 Mouse CGATAATGCCAAATTGGTAATTCAACAAGCAAGTAGGAATT Rat. ACATA ATGCCAGCAGAGTAA ATTGTTGCAGCAAGTAGGGCAG Human CTATAATGCCACTCCTGTAATTAGATAAGGAAGTAGGTCTC To test the hypothesis that the three conserved regions function as regulatory DNA, you make several transgenic constructs using a GFP reporter gene and you evaluate their expression in developing heart and lung tissue .Construct 1 is the wild-type construct. Notice that this constuct has normal expression in both tissues. For Constructs 2-8, you introduced point mutations into each of the three conserved regions (indicated by Expression results for each of these constructs are indicated in the chartExplanation / Answer
1. a. 4; b. 3
2. c. 5; d. 6
3. e. 4; f. 1
by observing the above mutations, we can conclude region 1 and region 3 both are required for the expression in heart. when either of this region is mutated, it is not expressed in heart.
region 2 is required for the expression in lungs. only the mutations in lungs affected the expression in lungs. neither mutations in region 1 nor mutations in region 3 affected expression in lungs.
Related Questions
Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.