1. Below is a single strand of DNA. If this sequence were a template during DNA

Question

1. Below is a single strand of DNA. If this sequence were a template during DNA replication, what would the final DNA look like? Show the functional chemical group that is always found at the 5’ and 3’ ends. 5’-GGATCTTATGTTTTATCACCCCAGACTTCTCTTAAAAACATTATTTAGTATGTAGCCTGCA-3’

2. What is the importance of the functional groups at the 5’ and 3’ end of any DNA?

3. The top strand of DNA shown above is the coding strand. What does an mRNA that results from this whole piece of DNA look like?

4. Show the correctly translated polypeptide that would result from your transcribed mRNA. 5. Identify the functional groups that are found at both ends of the polypeptide.

Explanation / Answer

1. The final DNA would be like:

CCTAGAATACTTTTTAGTGGGGTCTGAATTTTTGTAATAAATCATCATACATCGGACGT.

5' end of DNA has phosphate group while 3' end of DNA has hydroxyl group.

2. The phosphate group at 5' end of DNA allows ligation of nucleotides. It is also a site of post-transcriptional capping. On the other hand, 3' end of DNA is necessary for the synthesis of new nucleotide molecules, helps in determining the order of nucleotides in DNA. 3' end is also the site of post-transcriptional polyadenylation.

3. The mRNA strand looks like: with T replaced by U

GGAUCUUATGUUUUATCACCCCAGACUUCUCUUAAAAACAUUAUUUAGUAGUAUGUAGCCUGCA

Related Questions

Navigate

• Browse (All)
• Browse 1
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.