Show below is a double-stranded bacterial (S. enteric) DNA sequence coding for a
ID: 165891 • Letter: S
Question
Show below is a double-stranded bacterial (S. enteric) DNA sequence coding for a hypothetical protein. Both are strands are shown: the top strand reads 5' to 3' left to right, while the bottom strand reads 5' to 3' right to left. GT GTCCGT CTAATATT GTG AG AT GTT ATAT CCCGCCGT C AAC ACC AT C A A AC AGG ATAAT CGCCTGCT GGGGC AAAGGCGGT GAAGGTA AAGGT GTT GCC 3' 3' CACAGGCAGATTATAACACTCTACAATATAGGGCGGCAGTTGTGGTAGTTTGTCCTATTAGCGGACGACCCCGTTTCCGCCACTTCCATTTCCACAACGG 5' What are the first 15 nucleotides of the resulting mRNA? Right your answer from left to right in 5' to 3' fashion. Include 5' on the left of your sequence and 3' on the right of your sequence. Do not include any spaces.Explanation / Answer
Answer: 5’-CUAAUAUUGUGAGAU-3’
The given double-stranded bacterial (S. enterica) DNA sequence coding is;
5'-GTGTCCGTCTAATATTGTGAGATGTTATATCCCGCCGTCAACACCATCAAACAGGATAATCGCCTGCTGGGGC
AAAGGCGGTGAAGGTAAAGGTGTTGCC-3'
3'-CACAGGCAGATTATAACACTCTACAATATAGGGCGGCAGTTGTGGTAGTTTGTCCTATTAGCGGACGACCCCG
TTTCCGCCACTTCCATTTCCACAACGG-5'
Given that the transcription begins with and includes the red and underlined C/G (top strand/bottom strand) base pair and RNA polymerase proceeds from left to right along the DNA.
Bottom strand is used as a template for transcription.
The first 15 nucleotides of the template strand : 3’-GATTATAACACTCTA-5’.
The first 15 nucleotides of the resulting mRNA: 5’-CUAAUAUUGUGAGAU-3’
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.