B. What is the purpose of the -35 and -10 and what protein binds to it? What is
ID: 162546 • Letter: B
Question
B. What is the purpose of the -35 and -10 and what protein binds to it? What is the meaning behind numbers?
D. What is the RNA sequence of the ribosomal binding site.
Question Lac operon and gene regulation. 35 CRP ct ta gCgca. atta atgtgag 60 tagggtccgaaat gtgaaata, 5 Cgcgttgcgttaattacactcaatcgagtgagtaat 10 Cag aggaaa. ttgtgagoggataacaatt Caci tca tatgttgtgtgg gottccggctog Cgaaggccgagcatacaacacaccttaa cactcgcctattgt taaagtgtgtcctt tgtc 180 gatactggtactaatgcctaagtgaccggcagcaaaategt gcagcactgacccttttgg The above sequence shows a of the lac operon which contains the partial sequence following elements. CRP Binding site 35 and -10 promoter operator binding site sequence the transcriptional start site RBS ribosomal binding site other words the sequence that The initial 58 bps of the Lacz coding sequence (CDS)-in encodes for lac Z. Use the above to answer the following: of the mRNA sequence? A. What would be the first 20 bases, starting from the 5' end refer to? B. What is the purpose of the -35 and -1p? What do the numbers CO universal C. What is the mRNA of the first 20 bases of the lac operon? the D. What are the first 5 amino acid sequences for lacz (you will be given table in class)? protein sequence if were to delete 2 bases E. What would happen to the resulting we Sen from position 91-92? cuvud n Fahan at en t to femoral? reach Res during MENAExplanation / Answer
Answer:
B)
Initiation of transcription of gene is located on a region of DNA known as "Promoter" Transcription in prokaryotic DNA is intitiated at a promoter region. Prokaryotic promoter region as two short sequences towards upstream (5') known as
1) -10 element, at this promoter region, it has consensus sequence known as TATAAT.
2) -35 element, at this promoter region, it has consensus sequence known asTTGACA.
D)
RNA sequence of the ribosomal binding site: AGGAGG (consensus), this sequence is also known as Shine dalgaro sequence.
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.