(https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch) A) What gene wa
ID: 150495 • Letter: #
Question
(https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch) A) What gene was amplified B) From what organism the sequence came (scientific and common name), and C) in which Order that species is taxonomically placed. (9 pts)
TTATTACAGCATGAGAACAGCAGTTTATTACTCACTAAAGACAGAGTGAATGTAGAAAAGGCTGAATTCTGTAATAAAAGCAAACAGCCTGGCTTAGCAAGGCACCAACAGAGCAGATGGGCTGAAAGTAAGGAAACATGTAATGATAGGCAGACTCCCAGCACAGAGAAAAAGGTAGATGTGGCTGCTGATCCCCTGTATGGGCGAAAAGAACTGAATAAGCAGAAACCTCCATGCTCTGAGAGTCCTAGAGATACCCAAGATATTCCTTGGATAACGC
this is the information that I copied need help understanding it to answer questions
O Chlamyphorus truncatus partial breal gene for breast cancer 1, early onset, specimen voucher CT1 518 518 10096 5e-143 100% ER 512 512 100962e-1419996 ER 507 507 100961e-139 9996 AE 501 501 100965e-138 9996 LE 501 501 100965e-138 99% AF 496 496 100962e-136 99% LTE 496 496 100962e-136 99% LTE 496 496 100962e-136 99% LTE 496 496 100962e-1369996 LNI 496 496 100962e-136 9996 AE 496 496 10096 2e-136 9996 AE 496 496 100962e-136 99% AE 484 484 9896 5e-133 98% XM 484 484 9896 5e-133 98% XM 484 484 9896 5e-133 98% XM 484 484 10096 5e-133 98% AE 484 484 98% 5e-133 484 484 98% 5e-133 O Calyptophractus retusus partial brca1 gene for breast cancer 1, early onset artial Iol O Chaetophractus vellerosus partial BRCA1 gene for BRCA1. DNA repair associated,isolate CV1 O Chaetophractus vellerosus partial BRCA1 gene for breast cancer 1, early onset, isolate Cv1 Zaedy us pichiy BRCA1 gene partial cds O Chaetophractus villosus BRCA1 gene,partial cds O Tolypeutes matacus BRCA1 gene, partial cds BRCA1 Que Dasvpus novemcinctus BRCA1 gene, partial cdsExplanation / Answer
A) Gene ammplified is partial brac 1 gene for breast cancer 1.
This is because it shows 100 % allingnment with the search.
B) Organism name : Chlamyphorus truncatus(scientific name)
Pink fairy armalidio (common name)
After BLAST search in discription column first search result shows name of organism and the gene which is amplified : Chlamyphorus truncatus partial brac 1 gene for breast cancer 1.
C) Taxonomy : when we click on first allignment sequence result in description ,under the organism title we found the taxonomic information about the organism.
Kingdom : Animalia.
Phylum : Chordata
Class : Mammalia
Order : Cingulata
Family : Dasipodidae
Genus : Chlamyphorus
Species: Chlamyphorus truncatus
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.