Part 1 1. You set up a PCR reaction with the following single template (light bl
ID: 149280 • Letter: P
Question
Part 1 1. You set up a PCR reaction with the following single template (light blue) and 3 primers (dark blue). What region of the DNA template diagramed below in red would be amplified by the indicated PCR primers? Primer 1 Primer 2 5' 3 empateATCATTACTCCCATATCCATO AGTACTAOTCCTATGAST ATAGTCTAGGTACCTCATGAGGCTATAGGTACTCATGATCAGGATACTCA 3' 5' Primer 3 Products: Product A Product B Product C Product D Product E PCR Productchoose A, B, C, D, or E) Which of the three primers could be left out of the reaction without impacted the DNA amplification? Primer (choose 1, 2, or 3)Explanation / Answer
1. The correct option is ' Product B '.
Reason: Primer 1 and Primer 3 being the forward and reverse primers respectively will produce the amplicon size similar to product B.
2. To set up a successful PCR reaction we need
Tamplate, primers, nucleotide and polymerase.
3. NO. We do NOT expect to find a deletion of FUN gene in these transformants.
REASON: Without the addition of homologous sequence flanking the FUN gene in the amplified product, there will be NO crossinging over after transformation which would have produced deletion of the FUN gene in some transformants.
NOTE: To answer the Part-2 of the question we need to have Figure 2 abd Figure 3 of the handout which is not provided. Please provide the same. Thank you.
If you did not understand any part of the answer, please feel free to comment on the answer. I will be happy to help.
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.