Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

in the . This 36 amino acid long peptide is a potent vasoconstrictor eftect on f

ID: 147690 • Letter: I

Question

in the . This 36 amino acid long peptide is a potent vasoconstrictor eftect on fat storage. The sequence of the entire mRNA sequence of including 5' and 3' non-template sequence is shown below. A mutation (next to the asterisk) to change to a thymine The neuropeptide Y molecule is expressed in brain neurons sympathetic nervous s an neuropeptide Y in the gene can cause a guanine in the gene In the normal gene, this guanine is part of a codon that codes for a g acid/ glutamate. A genetic codon table is provided below a. Indicate the proper reading frame for this gene at the mutation site (don't show the reading frame for the entire sequence - just one codon). 1o double-check your work, here is an additional piece of information. The first three amino acids in neuropeptide Y are Y, P, S b. Indicate the consequences of the described mutation on the final peptide sequence GCACCCCATCCGCTGGCTCTCACCCCTCGGAGACGCTCGCCCGACAG CATAGTACTTGCCGCCCAGCCACGCCCGCGCGCCAGCCACCATGCTA GGTAACAAGCGACTGGGGCTGTCCGGACTGACCCTCGCCCTGTCCCT GCTCGTGTGCCTGGGTGCGCTGGCCGAGGCGTACCCCTCCAAGCCGG ACAACCCGGGCG AGGACGCACCAGCGGAGGACATGGCCAGATACTA CTCGGCGCTGCGACACTACATCAACCTCATCACCAGGCAGAGATATG GAAAACGATCCAGCCCAGAGACACTGATTTCAGACCTCTTGATGAGA GAAAGCACAGAAAATGTTCCCAGAACTCGGCTTGAAGACCCTGCAAT GTGGTGATGGGAAATGAGACTTGCTCTCTGGCCTTTTCCTATTTTCA GCCCATATTTCATCGTGTAAAACGAGAATCCACCCATCCTACCAATG CATGCAGCCACTGTGCTGAATTCTGCAATGTTTTCCTTTGTCATCAT TGTATATATGTGTGTTTAAATAAAGTATCATGCATTCAAAAGTGAAA Table of mRNA codons Second Base Third Base First phenylalanine serine phenylalanine scrine cysleine cysicine STOP tryptophan tyrosine STOP STOP proline proline histidine histidine lcucine ewinlinpia leucine proline glutamine arginine erine isolcucine isolcucine isoleucine START thrconine aspuragine threonine asparagine thrconine lysine threonine lysine senne glycine glycine glycine alanine valine valine

Explanation / Answer

a. The reading frame for the gene at the mutation site is 5' G*AG 3'.

b. If guanine in the gene is changed to thymine by mutation then it becomes T*AG. When it is transcribed, it is converted into U*AG. There are three stop codons such as UAA, UAG and UGA. G*AG becomes U*AG, a stop codon. If mutation creates a stop codon in between a reading frame, there will be a shorter length and nonfunctional protein translated.

Glutamic acid (GAG) has a specific role in the protein structure for electrostatic interactions with its proper positively charged amino acid partner. This is essential for whole protein function. But due to mutation it is converted into a stop codon, the truncated peptide may have no function in its expression site i.e, in brain neuron in sympathetic nervous system where it acts as a potent vasoconstrictor.