The Primer 3 software (http://primer3.wi.mit.edu/) was used to design primers ba

Question

The Primer 3 software (http://primer3.wi.mit.edu/) was used to design primers based on specific conditions. Each primer was checked using the IDT DNA software (http://www.idtdna.com). Results are shown below. Based on your knowledge, which primer set would you order? start len tm gc% any th 3'th hairpin seq LEFT PRIMER1 638 20 59.27 55.00 0.00 0.00 0.00 GAATTCTCAGAAGCCACcoc RIGHT PRIMER1 1182 20 59.03 55.00 0.00 0.00 0.00 AGGCAGACAGACAGACAGAC PRODUCT SIZE: 545, PAIR ANY TH COMPL: 0.00, PAIR 3' TH COMPL: 0.00 HOMO-DIMER ANALYSIS Dimer Sequence S- GAATTCTCAGAAGCCACCGC HOMO-DIMER ANALYSIS Dimer Sequence 5- AGGCAGACAGACAGACAGAC -3 Maximum Delta G-33.68 kcal/mole HETERO-DIMER ANALYSIS Primary Sequenee 5- GAATTCTCAGAAGCCACCGC 3' Maximum Delta G -39.68 kcal/mole 5'- AGGCAGACAGACAGACAGAC Delta G-8.51 kcal/mole Base Pairs Delta G -3.14 kcalmole Base Pairs 2 Maximum Delta G -39.68 kcal/mole GAATTCTCAGAAGCCACCGC AGGCAGACAGACAGACAGAC Delta G -6.21 kcal/mole Base Pairs 5" GAATTCTCAGAAGCCACCGC 3 CGOCACCGAAGACTCTTAAG 3 CAGACAGACAGACAGACGGA 3' CAGACAGACAGACAGACGGA Primer Set #2 start len tm gc% any th 3.th hairpin seq LEFT PRIMER2 484 20 58.88 55.00 0.00 0.00 0.00 GCCCTACAAGAATCCCGAGA RIGHT PRIMER 2 1068 20 59.14 55.00 0.00 0.00 0.00 CACACGCCAGTCTTTGAGTC PRODUCT SIZE: 585, PAIR ANY TH COMPL: 0.00, PAIR 3' TH COMPL: 0.00 HOMO-DIMER ANALYSIS Dimer Sequence 5- GCCCTACAAGAATOCCGAGA HOMO-DIMER ANALYSIS Dimer Sequence 5- CACACGCCAGTCTTTGAGTC HETERO DIMER ANALYSIS Primary Sequence 5- GCCCTACAAGAATCCCGAGA Maximum Delta G-39.74 kcal/mole Maximum Delta G -36.41 kcalmole Delta G -3.61 kcal/mole Base Pairs 5 GCCCTACAAGAATCCCGAGA Delta G 3.61 kcal/mole Base Pairs 5' CACACGCCAGTCTTTGAGTC Secondary Sequence 5- CACACGCCAGTCTTTGAGTC- 3 Maximum Delta G -39.74 kcaWmole 3' AGAGCCCTAAGAACATCCCG Delta G -5.12 kcal/mole Base Pairs 5' GCCCTACAAGAATCCCGAGA 3CTGAGTTTCTGACCGCACAC

Explanation / Answer

In order to identify a good primer, some points must be taken into account as follows:

According to the information, both primer sets have a good GC content as well as comparable melting temperature. However, looking at the data of self-complementarity by homo-dimer analysis, it can be seen that the free energy change for first set is too high as compared to second set. This means that the first primer set have high tendency of self-polymerization and a large amount of energy is required to separate these strands from each other. This would reduce the PCR efficiency.

Thus, the primer pair 2 is good for conducting experiments.

Related Questions

Navigate

• Browse (All)
• Browse T
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.