Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Genetics Lab #2, Promoter Analysis Student Name: Team Members: 3. Rob is one of

ID: 144210 • Letter: G

Question

Genetics Lab #2, Promoter Analysis Student Name: Team Members: 3. Rob is one of the DNA binding proteins, or transcriptio antibiotic resistance in bacteria. Below is a diagram of the active and inactive states o Rob. n factors, that are involved in Image that your research team recently found out that high activated pr Rob transcription factor was correlated with antibiotic resistance to colistin. Devise your team's strategy to block high levels of Rob activity. (10 points). otein levels of Extemal signal (e.g bile) Released Rob (active) Sequestered Rob (inactive) Regulon TS TS obbox From Figure 1C, Duval and Lister (2013). Legend Bile, secreted for digesting lipids in small intestine. Regulon: A set of genes that are controlled as an entire unit by activated transcription factor. These sets of genes may act as activators or silencers. TS: Transcriptional start site robbox: DNA sequence promoter TTCCCGTAATCGCACGGGTGGATAAGCGTTTACAGTTTTCGCAA recognized by Rob soxbox robbox . 35 AAGGGCATTAGCGTGCCCACCTATTCGCAAATGTCAAAAGCGTT from Figure 1, Jair, et al. (1996). Team's strategy to block high levels of Rob activity

Explanation / Answer

AcrAb-TolC efflux pump is playing important role in the expression of Rob protein. It is an efflux pump which found mainly in E. coli bacteria. It effluxsbthe decanoate and unconjugated bile salts where bile salt is observed to make bacteria more resistance to lipophilic antibiotics and decoanote upregulates the activity of Rob protein. AcrAB efflux pump is mediated by Rob protein.

MarA, SoxS and Rob are the member of AraC/xyls family of transcription regulator. Upregulation of MarA and SoxS downregulates the expression of Rob protein.

Decanoate is known to increase the expression of Rob while SoxS expression is increased by paraquate . Paraquate oxidized SoxR protein and this oxidized form of SoxR stimulates the expression of SoxS that means large amount of SoxS will downregulates the expression of Rob.

As Rob is thought to mediate the expression of AcrAB efflux pump. So when Rob is downregulated by SoxS then AcrAB efflux pump will also be inactivated result of that no transport of bile salts.

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote