1 atggcaactctaaaggatcagctgatttataatcttctaaaggaagaacagaccccccag 61 aataagattacagt

Question

1 atggcaactctaaaggatcagctgatttataatcttctaaaggaagaacagaccccccag

61 aataagattacagttgttggggttggtgctgttggcatggcctgtgccatcagtatctta

121 atgaaggacttggcagatgaacttgctcttgttgatgtcatcgaagacaaattgaaggga

181 gagatgatggatctccaacatggcagccttttccttagaacaccaaagattgtctctggc

241 aaagactataatgtaactgcaaactccaagctggtcattatcacggctggggcacgtcag

301 caagagggagaaagccgtcttaatttggtccagcgtaacgtgaacatctttaaattcatc

361 attcctaatgttgtaaaatacagcccgaactgcaagttgcttattgtttcaaatccagtg

421 gatatcttgacctacgtggcttggaagataagtggttttcccaaaaaccgtgttattgga

481 agtggttgcaatctggattcagcccgattccgttacctgatgggggaaaggctgggagtt

541 cacccattaagctgtcatgggtgggtccttggggaacatggagattccagtgtgcctgta

601 tggagtggaatgaatgttgctggtgtctctctgaagactctgcacccagatttagggact

661 gataaagataaggaacagtggaaagaggttcacaagcaggtggttgagagtgcttatgag

721 gtgatcaaactcaaaggctacacatcctgggctattggactctctgtagcagatttggca

781 gagagtataatgaagaatcttaggcgggtgcacccagtttccaccatgattaagggtctt

841 tacggaataaaggatgatgtcttccttagtgttccttgcattttgggacagaatggaatc

901 tcagaccttgtgaaggtgactctgacttctgaggaagaggcccgtttgaagaagagtgca

961 gatacactttgggggatccaaaaggagctgcaatttggtagctcgagccatcaccatcac

1021 catcactag

3. Internet problem: Using the hLDHA DNA sequence above I would like you to determine the following parameters for our recombinant version of the isoform. For this problem I strongly sug http://www.expasy.org. In this site I would look through their "proteomics" page that has a number of helpful tools including a translation tool and a protein parameter calculation tool (5 points). LD-5 gest you visit the following URL: a. b. c. d. e. Molecular mass of a subunit: Molecular mass of the functional LD-5 isoform: Theoretical pl: Number of total atoms: Ext. coefficient assuming that all cysteine residues are reduced. . Internet problem: In the last 15 years, it has become increasingly common to us some version of a "Hot start" PCR protocol and there are many commercially available "Hot start" PCR mixes on the market. We are going to use Clone

Explanation / Answer

Using expasy tools

the molecular mass is : 39901.84

extinction cofficient: 44920

Related Questions

Navigate

• Browse (All)
• Browse 1
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.