1. How did Natasha’s innate immune system try to protect her from the infection?

Question

1. How did Natasha’s innate immune system try to protect her from the infection? (make sure it is specific for this type of attack) (Natasha has Q fever)

2. Please describe the acquired immune reaction that occurred in response to this infection. (make sure it is specific for this type of attack)

3. You sent off a sample for sequencing in order to aid in prescribing the proper treatment and got the following sequence back:

TGGATTATGCGATGTCGGTCATTTTGGACCGGGCTTTGCGCATATCGCAGACGGTTTAAAGCCCGTCCAGCGTCGAATCGTGTACGCCATGTCAGAATTGGGTTTAAAATCAACCGCTAAGTATAAGAAATCAGCGCGGACGGTAGGCGACGTTTTGGGTAAATTCCATCCGCACGGAGACACCGCCTGTTACGAGGCCATGGTATTGATGGCCCAACCTTTTTCATTTCGCTATCCCTTTGTCGATGGGCAAGGCAATTGGGGGAGCGCGGATGATCCC AAATCCTTTGCCGCCATGCGTTATACGGAAGCACGTCTG

Describe the complete process, step by step, that this protein plays a role in.

Explanation / Answer

1. Q fever is caused by Coxiella burnetii. Plasmacytoid dendritic cells play an important role in innate immunity via the production of type I interferon. Coxiella burnetii interact with Plasmacytoid dendritic cells that resulted in the increased the expression of activation CD86 and CCR7. Genes responsible for coding chemokines,type I INF , cytokines, chemokines,were up-regulated.

Related Questions

Navigate

• Browse (All)
• Browse 1
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.