29 In Sanger UT EID: sequencing, what causes DNA synthesis to terminate at a spe
ID: 132615 • Letter: 2
Question
29 In Sanger UT EID: sequencing, what causes DNA synthesis to terminate at a specific base? A chemicals that cleave DNA after particular bases B. nucleotides that lack a 5' phosphate C. nucleotides that lack a base D nucleotides that lack a hydrogen at the 3' position E. nucleotides that lack a hydroxyl at the 3' position 30 Will BamHI restriction enzyme that cuts 5' G GATCC 3 make sticky ends (with what kind of overhangs) or blunt ends? A. sticky ends with 5 overhangs B. sticky ends with 3' overhangs C. sticky ends with both 5 and 3' overhangs D. blunt ends 31. When an insert with BamHl-cut ends is ligated with a plasmid vector with a single BamHil site, how many BamHl site(s) is/are there in the recombinant DNA and how many band(s) would you see on a gel when you digest your recombinant DNA with BamHI? A. 0 site: 1 band B. 1 site: 1 band C. 2 sites: 1 band D. 2 sites; 2 bands E. cannot be determined 32. What is the correct order of steps for sequencing a genome? 1) Sequencing DNA fragments of many overlapping dlones 2) Assembling the sequences 3) Isolating genomic DNA from many celils from a tissue sample 4) Fragmenting the genome with restriction enzyme or by sonication 5) Cloning DNA fragments to make genomic libraries A. 35142 B. 31542 C. 34512 D. 34521 E. 34152 33. One of the following sequences was obtained from a cloned piece of a genome that includes parts of two exons of a gene. The other sequence was obtained from the corresponding part of a cDNA clone representing the mRNA for this gene. What is the sequence of an intron separating two exons? Sequence 1 5'TAGGTGAAAGAGTAGCCTAGAATCAGTTA 3 Sequence 2 5 TAGGTGAAAGAAATCAGTTA 3 A. AGCCT B. GTAGCCTAG C. TAGGTGAAAGAExplanation / Answer
29) Sanger's method is a DNA sequencing technique first developed by Frederick Sanger in the year 1977. The reagent most commonly used is 1-Fluoro-2,4 dinitrobenzene. The dinucleotide triphosphate terminate chain elongation. These chain terminating substance lacks 3' - OH group that is needed for the formation of phosphodiester bind between the two nucleotides. So, the answer for this question is option E.
Please post other questions separately.
Related Questions
Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.