? 24bp C. 256 bp D 1296 bp EMO96 bp 2 What is the ap enzymethetumber of fragment
ID: 132607 • Letter: #
Question
? 24bp C. 256 bp D 1296 bp EMO96 bp 2 What is the ap enzymethetumber of fragments made if 16kb DNA is digested with a restriction has a 6 base A 1 fragment (B 2 fragments C. 4 fragments D. 6 fragments E. 12 fragments For 3-5: You performed the peaks is a Sanger sequencing reaction and obtained the following result. The height of Sanger unimportant. The 5 end of the sequence is at the left of the trace. 3. Would the sequence of the trace? primer, which is not shown, be located to the left or to the right of this A To the left To the right 4. What is the sequence of the smallest DNA molecule that contains dideoxyC (ddC) in the reaction? (ignore the primer.) A. 5' TTTGC 3 C. 3 AAC 5 D. 3'AACA 5 E. 5 TTTGCTTTGTGAGCGGATAACAA 3'Explanation / Answer
b) Answer is C (4 fragments)
DNA to be digested= 16000 bases
Restriction enzyme has 6 base recognition site.
The probability of finding one restriction site is one in every (1/4^6)= 1/4096 bases.
If the enzyme cuts every single restriction site, this will make 16000/4096= 3.9 cuts (n)
After making, say 3 cuts, no. of fragments will be n+1= 4
c) Answer is b ( to the right)
For sanger sequencing method, a complementary strand of the test sequence need to be synthesized (in the presence of 4 different dideoxynucleotides in 4 different tubes). As sequence is always synthesized from 5' to 3' direction using parental 3' to 5' sequence, therefore primer will be laid in the right of the test sequence.
d) As the primer makes strand in 5' to 3' direction, the smallest fragment containing ddc should be TTGTTATdc (which is not given in the options)
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.