Which positions in the purine ring of a purine nucleotide in DNA have the potent

Question

Which positions in the purine ring of a purine nucleotide in DNA have the potential to form hydrogen bonds but arc not involved in Watson-Crick base pairing? Draw the following structures and rate their relative solubilities in water (most soluble to least soluble): deoxyribose, guanine, phosphate. How arc these solubilities consistent with the three-dimensional structure of double-stranded DNA? One strand of a double-helical DNA has the sequence (5')GCGCAATATTTCTCAAAATATTGCGC(3'). Write the base sequence of the complementary strand. a. What special type of sequence is contained in this DNA segment? b. Does the double-stranded DNA have the potential to form any alternative structures? Calculate the standard free-energy change for each of the following enzyme-catalyzed reactions, using the equilibrium constants given for the reactions at 25 degree C and pH 7.0. (a) Glutamate + oxaloacetate aspartate aminotransferase aspartate + a-ketoglutarate K' eq = 6.8 (b)Dihydroxyacetone phosphate triose phosphate isomerase glyceraldehyde 3-phosphate K'eq = 0.0475 (c) Fructose 6-phosphate + ATP fructose phosphofructokinase 1, 6- bisphosphate + ADP K'eq = 254 Free Energy of Hydrolysis of CTP Compare the structure of the nucleoside triphosphate CTP with the structure of ATP. Now predict the K'eq and G' degree for the following reaction: ATP + CDP ADP + CTP

Explanation / Answer

QUESTION 1

Which positions in the purine ring of a purine nucleotide in DNA have the potential to form hydrogen bonds but are not involved in Watson-Crick base pairing?

Answer

All purine ring nitrogens (N-1, N-3, N-7, and N-9) can possibly frame hydrogen bonds .

In any case, N-1 is included in Watson-Crick hydrogen holding with a pyrimidine, and N-9 is included in the N-glycosyl linkage with deoxyribose and has exceptionally constrained hydrogen-holding limit.

Along these lines, N-3 and N-7 are accessible to shape facilitate hydrogen bonds

================================================================================

QUESTION 3

One strand of a double-helical DNA has the sequence (5)GCGCAATATTTCTCAAAATATTGCGC(3). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment?

Does the double-stranded DNA have the potential to form any alternative structures?

Answer

The complementary strand is (5’)GCGCAATATTTTGAGAAATATTGCGC(3’)

53 direction.)

This sequence has a palindrome, an inverted repeat with twofold symmetry: (5)GCGCAATATTTCTCAAAATATTGCGC(3)

(3)CGCGTTATAAAGAGTTTTATAACGCG(5)

Because this sequence is self-complementary, the individual strands have the potential to form hairpin structures. The two strands together may also form a cruciform.

Related Questions

Navigate

• Browse (All)
• Browse W
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.